debar
is an R package designed for denoising high
throughput sequencing data for the animal DNA barcode marker cytochrome
c oxidase I (COI-5P, or the five prime portion of COI). The package is
designed to detect and correct insertion and deletion errors within
sequencer outputs. This is accomplished through comparison of input
sequences against a profile hidden Markov model using the Viterbi
algorithm (debar
depends on functions from the R
package aphid for
running the Viterbi algorithm). Inserted base pairs are removed and
deleted base pairs are accounted for through the introduction of a
placeholder character. Since the PHMM is a probabilistic representation
of the COI barcode, corrections are not always perfect. For this reason
debar
censors base pairs adjacent to reported indel sites,
turning them into placeholder characters (default is 7bp in either
direction, this feature can be disabled). Testing has shown that this
censorship results in the correct sequence length being restored, and
erroneous base pairs being masked the vast majority of the time
(>95%).
The package is designed to detect and correct insertion and deletion errors within sequencer outputs. This is accomplished through comparison of input sequences against a profile hidden Markov model using the Viterbi algorithm. The Viterbi path produced by this comparison is used to identify where insertion or deletion errors exist. Here is a small example of how the package corrects indels in this manner:
#Correcting insertions
#the 'G' in this sequence is an insertion
"ATCATGATC"
#the sequence is compared to the PHMM, producing a Viterbi path
#the 'G' is assigned a hidden state of 'insert', indicated by a 2 in the path
"111112111"
#debar uses this information to alter the sequence, removing the G
"ATGATATG"
For deletion errors the inverse action is performed and a placeholder character is inserted.
debar
is dependent on the aphid
package for comparison of sequences against a COI-5P nucleotide
PHMM. The package ape
is a requirement because sequences
are internally converted to ape
“DNAbin” objects. The
package sequinr
is utilized in obtaining the reverse
compliment of input sequences when needed. The parallel
package is also required for parallelization of the denoising
process.
When working with sequence data in R, debar
can be
applied to a set of reads (either those linked to a given sample or
those from a given set of clustered sequences). Note that for best
performance reads should already be demultiplexed, dereplicated, and
filtered based on quality. A list of sequences can be denoised with the
denoise_list
function.
denoise_list
operates on a sequence-by-sequence basis
and is therefore parallelized to improve performance. The
cores
argument allows a user to specify the number of cores
across which the processes should be parallelized.
Passing the option keep_flanks=FALSE
to the
denoise_list
function will put all of the outputs into a
common reading frame. This allows for the output lists to be combined to
produce a consensus sequence.
ex_out = denoise_list(ex_nt_list, keep_flanks=FALSE)
debar
can provide a more accurate consensus sequence for
a sample by removing errors in component reads and ensuring that all
data conform to the known amplicon structure. The denoising process
yields a series of indel corrected sequence reads, which can be combined
to obtain a biologically informed consensus if the reads are derived
from a single sample or from a sufficiently similar set of metabarcode
outputs. The censorship process effectively removes indel errors the
majority of the time and also restores the proper length of the
sequence. This comes at the cost of missing information in individual
sequences. The combination of denoised sequences from a given sample or
amplicon variant allows the full barcode to be obtained in most
instances using the consensus_sequence
function.
# truncated example of debar outputs for a given sample
# indels corrected and area masked with 'N' placeholders
CTCTACTTGNNNNNNNNNNNNNNAGCAGGAATAGTTGGAATAGCTTTAAGTTTACTAATTCGCGCTGAACTAGGT
CTNNNNNNNNNNNNNNNTGCATGAGCAGGAATAGTTGGAATAGCTTTAAGTTTACTAATTCGCGCTGAACTAGGT
CTCTACTTGATTTTTGGTGCATGAGCAGGAATAGTTGGAATAGCTTTAAGTTTNNNNNNNNNNNNNNAACTAGGT
# following assignment to samples (barcoding) or OTU clustering (metabarcoding)
# a denoised barcode can be obtained from the consensus of the denoised reads
CTCTACTTGATTTTTGGTGCATGAGCAGGAATAGTTGGAATAGCTTTAAGTTTACTAATTCGCGCTGAACTAGGT
Note: If you are interested in identifying which consensus sequences
do not conform to the COI amplicon structure, as opposed to denoising
the sequences, then consider employing debar
s sister
package: coil
The program contains a wrapper function denoise_file
that allows for a user to run the entire denoiser pipeline in a single
step (there are quantitatively informed defaults for executing the full
pipeline, but it is highly recommended that a user acclimate themselves
to the denoise
pipeline options to ensure that the
parameters make sense for their given data set and analysis goals).
All that is needed is for the input and output files to be specified.
The program by default will read in the input file, run each sequence
through the denoising algorithm, and then output the denoised sequences
to the specified output file. The denoise pipeline contains certain
rules (that a user can control - see below for details on these
parameters) that lead to some sequences being rejected entirely, the
keep_rejects
option allows a user to output these rejected
sequences to another file for further inspection. The program also has
an option for generating a simple log file, and allows for multicore
execution of the denoising pipeline by simply specify the number of
cores the process should utilize. Additionally you can type
?denoise
to see a list of all available denoise parameters
that can be passed to the denoise_file
wrapper function as
well (parameters are explored in more detail below).
debar
can operate on inputs from fasta and fastq files,
or their gzipped equivalents. For demonstration of the workflow,
debar
contains three example files.
#The following example file is used as an input in the vignette
fastq_example_file = system.file('extdata/coi_sequel_data_subset.fastq.gz',
package = 'debar')
#other example data also available in debar:
#fastq_example_file = system.file('extdata/coi_sequel_data_subset.fastq',
# package = 'debar')
#fasta_example_file = system.file('extdata/coi_sequel_data_subset.fasta',
# package = 'debar')
# NOTE - this block of code is not run so as to avoid the generation of output files!
#
# Our input file with noisy sequence data is fastq_example_file.
# Output file is "example_output.fastq"
# If you do wish to run these examples, then please double check your working directory!
denoise_file(fastq_example_file, filename = "example_output.fastq")
denoise_file(fastq_example_file, filename = "multicore-example_output.fastq",
multicore = 8, log_file = TRUE, keep_rejects = TRUE)
File-to-file denoising can also be parallelized across multiple CPU cores. The denoising of each sequences in the input file is conducted separately, so using multiple cores will decrease the time needed to complete denoising roughly by a factor of the number of cores used. If you are denoising complete sequencer outputs, it is highly recommended that you do so with as many cores as possible. For example, denoising of 160,000 sequence reads on a 64-core server (all default parameters) takes approximately 1hr and 42 minutes, while on a laptop with only 8 cores would take almost 14 hours!
#debar works best when the tasks are highly parallelized
denoise_file(fastq_example_file, filename = "multicore-example_output.fastq",
multicore = 8, log_file = TRUE, keep_rejects = TRUE)
#set the multicore parameter to the number of CPU cores available
Certain parameter selections can further increase the speed with
which debar
can process data, but come with certain trade
offs (that may or may not be worth consideration in the processing of
your own data). The most drastic speed improvement is provided by
disabling the direction check (dir_check). By default both the forward
and reverse compliments of a read are compared to the PHMM, if your data
consists only of forward reads, then disabling this option will result
in a 30-50% reduction in processing. Other speed/accuracy trade offs are
available and discussed within the ‘Recommended parameter combinations’
section of the package’s vignette.
DNA metabarcoding analyses often target shorter, standardized sections of the full COI barcode region for amplification and sequencing. If the targeted section is known, the performance of debar can be optimized by denoising the sequence using a customized subset of the complete PHMM, corresponding to given region. This will reduce the probability of spurious profile matches, and increase the accuracy of the indel corrections performed.
debar’s sister package, coil contains a function
subsetPHMM
, which can be used to extract a section of the
complete 657bp PHMM for the COI region. Below this process, and the
application of the custom model in the denoising of a barcode sequence
fragment are demonstrated.
#install.packages('coil')
# These variables define the region of the Folmer region we are targeting.
nt_start = 295
nt_end = 636
# Take the complete PHMM, and create a new PHMM that represents
#a specific subsection of the COI Folmer region.
subsection_phmm = coil::subsetPHMM(debar::nt_coi_PHMM, start = nt_start, end = nt_end)
# Here is an example sequence with a T added at position 81.
ex_error = paste0(c("tccgcaggagtagaagctggagcaggaaccggatgaactg",
"tatatcctcctttagcaggtaatttagcacatgctggccacctctgttgatttagccatctttt",
"cccttcatttggccggtatctcatcaattttagcctctattaattttattacaactattatta",
"atataaaacccccaactatttctcaatatcaaacaccattatttgtttgatctattcttatcac",
"cactgttcttctactccttgctctccctgttcttgcagccggaattacaatattattaacagacc",
"gcaacctcaacactacattctttgaccccgcagggggaggggacc"), collapse = "")
# Run the denoise function, with the constrained PHMM.
subset_has_error_outpt = denoise(ex_error, nt_PHMM = subsection_phmm)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3085 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3082 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3079 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3083 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3086 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3085 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3082 >= vector size 3078)
## Warning in .ViterbiP(y, A, E, qe, qey, type, windowspace, offset, DI, ID, :
## subscript out of bounds (index 3079 >= vector size 3078)
## A DNAseq object.
## Raw Sequence:
## tccgcaggagtagaagctggagcag...tttgaccccgcagggggaggggacc
## Corrections applied: 1
## Output Sequence:
## TCCGCAGGAGTAGAAGCTGGAGCAG...TTTGACCCCGCAGGGGGAGGGGACC
Funding for the development of this software was provided by grants in Bioinformatics and Computational Biology from the Government of Canada through Genome Canada and Ontario Genomics and from the Ontario Research Fund. Funders played no role in the study design or preparation of this software.